Target gene | Primer name and sequences (5′ ➔ 3′) | Amplicon size (bp) | Thermal program | References | |
---|---|---|---|---|---|
18S rRNA | EuK1A: CTGGTTGATCCTGCCAG 499R: CACCAGACTTGCCCTCYAAT | ~500 | 94 °C × 5 min, 35 cycles of 30 s at 94 °C, 60 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C. | ||
ITS | ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC | ~500 | 95 °C × 15 min, 35 cycles of 30 s at 95 °C, 30 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C. | [42] | |
β-tubulin (qPCR) | BT107F: AACAACTGGGCIAAGGTYACTACAC BT261R: ATGAAGAAGTGGAGICGIGGGAA | ~450 | Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 30 s at 60 °C. | [43] | |
16S rRNA | 341F: CCTACGGGAGGCAGCAG R806: GGACTACHVGGGTWTCTAAT | ~465 | 94 °C × 5 min, 35 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 10 min at 72 °C. | ||
cpn60 | H279: GAIIIIGCIGGIGAYGGIACIACIAC H280: YKIYKITCICCRAAICCIGGIGCYTT H1612: GAIIIIGCIGGYGACGGYACSACSAC H1613: CGRCGRTCRCCGAAGCCSGGIGCCTT | ~578 | 3 min at 94 °C, 40 cycles of 30 s at 94 °C, followed by a temperature gradient of 1 min at 42 °C, 48 °C, 54 °C, or 60 °C, and 1 min at 72 °C, followed by a final extension of 10 min at 72 °C. | [46] | |
16S rRNA (qPCR) | 341F: CCTACGGGAGGCAGCAG 518R: ATTACCGCGGCTGCTGG | ~194 | Incubation 2 min at 50 °C. Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 20 s at 60 °C. | [44] | |
uidA (qPCR) | 784F: GTGTGATATCTACCCGCTTCGC 866R: GAGAACGGTTTGTGGTTAATCAGGA EC807: FAM-TCGGCATCCGGTCAGTGGCAGT-BHQ1 | 84 | Incubation 2 min at 50 °C. Initial denaturation 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. | [47] | |
g23 (qPCR) | MZIA1bis: GATATTTGIGGIGTTCAGCCIATGA MZIA6: CGCGGTTGATTTCCAGCATGATTTC | ~471 | 94 °C × 1.5 min, 35 cycles of 45 s at 94 °C, 60 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C. | Incubation 2 min at 50 °C. Initial denaturation for 20 s at 95 °C, 40 cycles of 1 s at 95 °C and 30 s at 60 °C. | [20] |
RdRp | RdRp1: GGRGAYTACASCIRWTTTGAT RdRp2: MACCCAACKMCKCTTSARRAA | ~450 | 94 °C × 75 s, 40 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C. | [26] |